دانلود جزوه بخش سوم ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast

دانلود جزوه بخش سوم ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast
نوع فایل
pdf
حجم فایل
407KB
نویسنده
دسته بندی
تعداد بازدید
470 بازدید
6,000 تومان 4,500 تومان٪25 تخفیف

دانلود جزوه بخش سوم ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast

قابل توجه کاربران و دانشجویان عزیز و گرامی: فایلی که هم اکنون معرف حضور شماست جامع ترین و کامل ترین فایل pdf جزوه بخش سوم ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast می باشد. این فایل شامل ۵ صفحه می باشد. و در غالب فرمتpdf تهیه شده و هم اکنون آماده دانلود است. امیدواریم که سودمند بوده و مورد استفاده شما سروران گرامی واقع گردد. در صورت تمایل و نیاز می توانید این فایل ارزشمند و مفید را از فروشگاه سایت یوفایل با مناسب ترین قیمت خریداری و دانلود نمایید.

بخش سوم: ارزیابی کیفیت پرایمرهای طراحی شده با استفاده از Primer Blast

پس از طراحی پرایمرهای مورد نظر، باید اختصاصی بودن پرایمرها را مورد بررسی قرار دهیم تا اطمینان حاصل کنیم که پر ایمرهای طراحی شده فقط قطعه ی مورد نظر ما را تکثیر خواهند کرد. برای این منظور به سایت NCBI مراجعه کرده و به بخش BLAST و سه س به Primer Blast مراجعه میکنیم. برای آموزش این بخش، پرایمرهای مستقیم CCAGGTTTCCCAGTTTAATTCC و معکوسAACCCAGAATCCTGTCACCA را از نظر اختصاصیت بررسی میکنیم. این جفت پرایمر، اگزون شماره ۱ ژن RB1 را تکثیر میکنند. توالی پرایمر مستقیم و معکوس را در بخش Primer Parameters و در باکسهای Forward و Reverse Primer وارد میکنیم .

در بخش Database ، گزینهی Genome Reference را انتخاب نموده و در باکس ارگانیسم ، homo sapiens راتا ی میکنیم. سایر گزینه های نرم افزار را در حالت پیش فرض، قرار میدهیم. در پایان بر روی دگمه Get Primer کلیک میکنیم ) قابل ذکر است که با Primer Blast میتوان پرایمر هم طراحی نمود.

جمله توالی، طول، Tm ، درصد GC پرایمرهای مستقیم و معکوس و همچنین احتمال تشکیل دایمر را میتوان مشاهده کرد. اختلا Tm دو پرایمر حدود ۰٫۷ درجه سانتیگراد است که قابل قبول میباشد. بیشینه قابل قوول Self-Complementarity برای پرایمرها، ۸ و در حالت ایده آل ۰ است. بیشینه قابل قبول برای Self 3′ Complementarity برای پرایمرها، ۳ و در حالت ایده آل ۰ میباشد. محصول اختصاصی این پرایمرها یک قطعه ۶۳۶ جفت بازی است.

مطالعه بیشتر

راهنمای خرید:
  • لینک دانلود فایل بلافاصله بعد از پرداخت وجه به نمایش در خواهد آمد.
  • همچنین لینک دانلود به ایمیل شما ارسال خواهد شد به همین دلیل ایمیل خود را به دقت وارد نمایید.
  • ممکن است ایمیل ارسالی به پوشه اسپم یا Bulk ایمیل شما ارسال شده باشد.
  • در صورتی که به هر دلیلی موفق به دانلود فایل مورد نظر نشدید با ما تماس بگیرید.